View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_64 (Length: 280)
Name: NF1711_low_64
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_64 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 266
Target Start/End: Original strand, 343060 - 343296
Alignment:
Q |
17 |
aaagtactatttcatcattaattaggaacttttgttgcatcaatggtgatgtcaatcatttcttccccaatattgcttcaagttcatcattaacaaaaat |
116 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
343060 |
aaagtactatttcatcatta----ggaacttttgttgcatcaatggtgatgtc---------ttccccaatattgcttcaagttcatcattaacaaaaat |
343146 |
T |
|
Q |
117 |
gtctatatcattttagcctttagtgtgttcaacttcttgagaaaagaatttgattgattattttatatttgcacaacctttccactaggggatagaacac |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
343147 |
atctatatcattttagcctttagtgtgttcaacttcttgagaaaagaacttgattgattattgtatatttgcacaacctttccactaggggatagaacac |
343246 |
T |
|
Q |
217 |
cgcgctcttgcatacatatatcatctttaaatttgaaatatgcatcacaa |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
343247 |
cgcgctcttgcatacatatatcatctttaaatttgaaatatgcatcacaa |
343296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4398 times since January 2019
Visitors: 5883