View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_66 (Length: 277)
Name: NF1711_low_66
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 18984902 - 18984638
Alignment:
| Q |
1 |
catatgacaaagcattcttctcagatggttttcatggctctttggttgaatatatggtccacgaaactgaaaagcttcatgcacaggtttttacattttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18984902 |
catatgacaaagcattcttctcagatggttttcatggctctttggttgaatatatggtccacgaaactgaaaagcttcatgcacaggttgttacattttt |
18984803 |
T |
 |
| Q |
101 |
gaggcgatgaaaatatggaaaagaaaagaatttcgtgattaaaatttttgtgcttggcttccctttttaaattaggtgggaagatatacaagcccggatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18984802 |
gaggcgatgaaaatatggaaaagaaaagaatttcgtgatttaaatttttgtgcttggcttccctttttaaattaggtgggaagatatacaagcccggatg |
18984703 |
T |
 |
| Q |
201 |
agcatgctttcttccctacaaacttacctgagccactgcttcctcccatgaagtacccacaggtt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18984702 |
agcatgctttcttccctacaaacttacctgagccactgcttcctcccatgaagtacccacaggtt |
18984638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 4248518 - 4248460
Alignment:
| Q |
24 |
gatggttttcatggctctttggttgaatatatggtccacgaaactgaaaagcttcatgc |
82 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||||| |||||||| ||||||||||| |
|
|
| T |
4248518 |
gatggatttcatggctctttggtagaatacatggtcagggaaactgagaagcttcatgc |
4248460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University