View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_91 (Length: 237)
Name: NF1711_low_91
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_low_91 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 43321914 - 43322139
Alignment:
| Q |
1 |
actcgtactctgtcgtggtacattatgtcgtg-------gcattgctcttataaaaaagcgggcaatgtcagaatattaagcaagctattcacgattaaa |
93 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43321914 |
actcatactctgtcgtggtacattatgtcgtgtactgtagcattgctcttataaaaaagcgggcaatgtcagaatattaagcaagctattcacgattaaa |
43322013 |
T |
 |
| Q |
94 |
gaaaaaacttgttaagctacttcaacattttatgaaatggaactatggaactaaatcgtgttgtccatgtagatttgtggtacccattaatgttcccatg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43322014 |
gaaaaaacttgttaagctacttcaacattttatgaaatggaactatggaagtaaatcgtgttgtccatgtagatttgtggtacctattaatgttcccatg |
43322113 |
T |
 |
| Q |
194 |
ttacgagtctttacatttgggagtct |
219 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43322114 |
ttacgagtctttacatttgggagtct |
43322139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University