View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1712-Insertion-6 (Length: 349)
Name: NF1712-Insertion-6
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1712-Insertion-6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 7 - 204
Target Start/End: Original strand, 8385412 - 8385609
Alignment:
| Q |
7 |
agtaattgtgttcaacggctctagttgtgatgtttagagacaatgaaatcacatctttgtggttggtgattttatgagttatgtttggttcagaggaaat |
106 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8385412 |
agtaattatgttcaactgctctagttgtgatgtttagagacaatgaaatcacatctttgtggttggtgattttatgagttatgtttggttcggaggaaat |
8385511 |
T |
|
| Q |
107 |
ggctgagaaacatagttcagggtagagagtggtggtgcaagcggatttgagtatggcgtgagaatggtgagagagtgaaagagaagatgaagcaatgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8385512 |
ggctgagaaacatagttcagggtagagagtggtggtgcaagcggatttgagtatggcgtgagaatggtgagagagtgaaagagaagatgaagcaatgc |
8385609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 244 - 349
Target Start/End: Original strand, 8385649 - 8385754
Alignment:
| Q |
244 |
caacaatggctgctatggaagctacaatgagaagggttgtaaagagggagatgaggagttttttcttgttgccggaattcgagattccggcgagggattg |
343 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8385649 |
caacaatggctactatggaagctacaatgagaagggttgtaaagagggagatgaggagttttttcttgttgccggaattcgagattccggcgagggattg |
8385748 |
T |
|
| Q |
344 |
ttttat |
349 |
Q |
| |
|
|||||| |
|
|
| T |
8385749 |
ttttat |
8385754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University