View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17120_low_11 (Length: 307)
Name: NF17120_low_11
Description: NF17120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17120_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 290
Target Start/End: Original strand, 19250857 - 19251126
Alignment:
| Q |
17 |
ttaataagcactctatcattcacgcttgaaatgttaacttaccagtaaagatttaaccttgtaatttaaaggtgttgggttcaaaaccaattgataaaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19250857 |
ttaataagcactctatcattcacgcttgaaatgttaacttagaggtaaagttttaaccttgtaatttaaaggtgttgggttcaaaaccaattgataaaaa |
19250956 |
T |
 |
| Q |
117 |
atttccccttgaagccctcttctatcttccccttaattggggtacctatgagacatcaatacttatgaagttaagcctctcgttgaggttggtctaagta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
19250957 |
atttccccttgaagccctcttctatcttcccctta----gggtacctatgagacatcaatacttatgaagttaagtctctcattgaggctggtctaagta |
19251052 |
T |
 |
| Q |
217 |
acttagtaaatctctttgttgtcgtttcttagtcgaaaagtgctttgataattttgtgtttggttgaaagttaa |
290 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19251053 |
acttagtaaacctctttgttgtcgtttcttagtcgaaaagtgctttgataattttgtgtttggttgaaagttaa |
19251126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University