View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17120_low_8 (Length: 421)
Name: NF17120_low_8
Description: NF17120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17120_low_8 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 408
Target Start/End: Complemental strand, 49230 - 48830
Alignment:
| Q |
1 |
ttcgtcgtcttcttcatcttcttcatcatctttattattactattattcttggtgttattggagatagtgtttttcacgtgaaccagttgttgttcatgg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49230 |
ttcgtcttcttcttcatcttcttcatcatctttattattactattattcttggtgtcattggagatagtgtttttcacgtgaaggtgttgttgttcatgg |
49131 |
T |
|
| Q |
101 |
atttgagagggttgtgaaaccaaggaatttgaatttgggtttacgggttctggttcggtttcgattggggagtctggtggcgattcttcgaatgctgctt |
200 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
49130 |
atttgtgagggttgtgaaatcaaggaattggaatttgggtttacgggttctggttcggtttcggttggggaatctggtggtgattcttcgaatgctgctt |
49031 |
T |
|
| Q |
201 |
cgaatggatcctttgattgcttcattcttgatcttgatcgattctgttggaaagttgttattagaagtgaaactctcgtcgctggggnnnnnnnnnnnng |
300 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| | |
|
|
| T |
49030 |
caaatggatcctttgactgcttcattcttgatcttgatcgattctgttggaaagttgttattggaagtgaaactctcgt--ttggg---tgtatatatag |
48936 |
T |
|
| Q |
301 |
gtttgtgttgtgggtggcttcttaggtaaggcaccaactgaagccatcacaagtgggcctaatgagtcaaaaataagtaggtcttcagtagaatgagatg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||| |||| |
|
|
| T |
48935 |
gtttgtgttgtgggtggcttcttaggtaaggcaccaactgaagccatcacaagtgggcctacttagtctaaaataagtaggtcttcagtagaat--gatg |
48838 |
T |
|
| Q |
401 |
atagcttc |
408 |
Q |
| |
|
|||||||| |
|
|
| T |
48837 |
atagcttc |
48830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 149 - 228
Target Start/End: Complemental strand, 17814792 - 17814713
Alignment:
| Q |
149 |
tctggttcggtttcgattggggagtctggtggcgattcttcgaatgctgcttcgaatggatcctttgattgcttcattct |
228 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17814792 |
tctggttcggtttcaattggggattctggtggtgattcttcgaatgctgcttcgaatggatcctttgattgcttcattct |
17814713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University