View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17122_high_4 (Length: 303)
Name: NF17122_high_4
Description: NF17122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17122_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 52972603 - 52972319
Alignment:
| Q |
1 |
ataaaggagcgatacgcaggtatgaccaaggcagatattgaaactcttaactctgattgaagttgttcatcgctcaccatccaactactttgcgtcttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972603 |
ataaaggagcgatacgcaggtatgaccaaggcagatattgaaactcttaactctgattgaagttgttcatcgctcaccatccaactactttgcgtcttgt |
52972504 |
T |
|
| Q |
101 |
ggatatcttcaaacatggaattgaaacacttaaacctctctctcaaaacctgcttagacaccttgttcccttgttgatgaaggccatctgggttaaggca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972503 |
ggatatcttcaaacatggaattgaaacacttaaacctctctctcaaaacctgcttagagaccttgttcccttgttgatgaaggccatctgggttaaggca |
52972404 |
T |
|
| Q |
201 |
ctgcaacaccttagtccaagtctctctctgataactcttatggtggaacttcaaacttgtttgcctcctcctgcaccagttatca |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52972403 |
ctgcaacaccttagtccaagtctctctctgataactcttatggtggaacttcaaacttgtttgcctcctcctacaccagttatca |
52972319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University