View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17122_low_11 (Length: 246)
Name: NF17122_low_11
Description: NF17122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17122_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 22045851 - 22045937
Alignment:
| Q |
1 |
acacgtgtccttagatatttcacactccctctcctcattttacctataaatgcgggttcaacccatgcttctatcattcagaagtaa |
87 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22045851 |
acacgtgtccttagatatttcacactctctctcctcatttttcctataaatgcgggttcaacccatgcttctatcattcagaagtaa |
22045937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 161 - 227
Target Start/End: Original strand, 22046002 - 22046068
Alignment:
| Q |
161 |
tgaaaatgtcttgctgtggtggaaactgtggttgtggaagtgcctgcaaatgcggcaatggctgtgg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22046002 |
tgaaaatgtcttgctgtggtggaaactgtggctgtggaagtgcctgcaaatgcggcaatggctgtgg |
22046068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University