View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17122_low_9 (Length: 261)
Name: NF17122_low_9
Description: NF17122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17122_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 3945666 - 3945878
Alignment:
| Q |
1 |
attcacatcacaagagttactacttgataaaccataaaacataggactaatattatgatttaaggttgaatttgaagaagtggtgtttggtgtggaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945666 |
attcacatcacaagagttactacttgataaaccataaaacataggactaatattatgatttaaggttgaatttgaagaagtggtgtttggtgtggaacta |
3945765 |
T |
|
| Q |
101 |
ggagttgaagaaggagaagaagaaatagaagtatcaatggtggagggtattttgatgagagtagtattgttactacgtttgtttgagttgtttcttctgt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945766 |
ggagtt---gaaggagaagaagaaatagaagtatcaatggtggagggtattttgatgagagtagtattgttactacgtttgtttgagttgtttcttctgt |
3945862 |
T |
|
| Q |
201 |
aaccaccaccaacagg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3945863 |
aaccaccaccaacagg |
3945878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University