View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17123_high_29 (Length: 260)
Name: NF17123_high_29
Description: NF17123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17123_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 3894163 - 3894413
Alignment:
| Q |
1 |
cgttcactttataaaccgatcaaatttcatgacagaaatagaaagaacacacattgtgatatcaaacacaaatnnnnnnnnnn-----------tagaaa |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
3894163 |
cgttcactttataaaccgatcaaatttcatgaccgaaatagaaa----acacattgtgatatcaaacacaaatattaaaaaaaaaaaaaaaaaatagaaa |
3894258 |
T |
|
| Q |
90 |
gaaacatggcagcaatgttcatcactagaaacgcaatcttccggttctcaaaggcattccctagcgtaccttcactcccccttcctaaaccctccagagt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894259 |
gaaacatggcagcaatgttcatcactagaaacgcaatcttccggttctcaaaggcattccctagcgtaccttcactcccccttcctaaaccctccagagt |
3894358 |
T |
|
| Q |
190 |
cttcgttgcttctgcttccaaccaatcagacgtaagttaacttcatcatttattt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894359 |
cttcgttgcttctgcttccaaccaatcagacgtaagttaacttcatcatttattt |
3894413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University