View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17123_high_38 (Length: 240)
Name: NF17123_high_38
Description: NF17123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17123_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 21 - 215
Target Start/End: Complemental strand, 28189982 - 28189792
Alignment:
| Q |
21 |
aatagctacttcactatttcatgatggagctgcggaggatgagacacatatggatttcctaggtagtacgccccacttctatttatagagaaatgaacca |
120 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
28189982 |
aatagctatttcactatttcatgatggagctgtggaggatgagacacatatggatttcctaggt--ta--ccccacttctatttatagagaaatgaacca |
28189887 |
T |
 |
| Q |
121 |
ctaaaatgttaagactcatattttttggactctataatatacatatcttaaattgttttaaatttgaagtaaaatcttcagtatatgacaaacac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28189886 |
ctaaaatgttaagactcatattttttggactctataatatacatatcttaaattgttttaaatttgaagtaaaatcttcagtatatgacaaacac |
28189792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University