View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17123_low_23 (Length: 314)
Name: NF17123_low_23
Description: NF17123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17123_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 198 - 298
Target Start/End: Complemental strand, 24976087 - 24975987
Alignment:
| Q |
198 |
gttatgatagatatgatctgtttggggtgtgataggaagagagataaaaagaaaatgatctctaaaatgagtgtagagaaattagaggtgtctatatata |
297 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24976087 |
gttatgatagatatgatccgtttagggtgtgataggaagagatataaaaagaaaatgatctctaaaataagtgtagagaaattagaggtgtctatatata |
24975988 |
T |
 |
| Q |
298 |
a |
298 |
Q |
| |
|
| |
|
|
| T |
24975987 |
a |
24975987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 102 - 189
Target Start/End: Complemental strand, 24976220 - 24976133
Alignment:
| Q |
102 |
tattaaagataatcaaaatatgattgcaatcatgttgatagagaagagagaaacattgagttccagataataatttgtgtacactata |
189 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24976220 |
tattaaagataatcaaaacatgattgcaatcatgttgatggagaagggagaaacattgagttccagataataatttgtgtacactata |
24976133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 202 - 255
Target Start/End: Complemental strand, 4123223 - 4123170
Alignment:
| Q |
202 |
tgatagatatgatctgtttggggtgtgataggaagagagataaaaagaaaatga |
255 |
Q |
| |
|
|||||||| |||| |||| | | ||||||||||||||||||||| ||||||||| |
|
|
| T |
4123223 |
tgatagatttgatatgttggtgatgtgataggaagagagataaagagaaaatga |
4123170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University