View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17123_low_29 (Length: 280)
Name: NF17123_low_29
Description: NF17123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17123_low_29 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 9 - 280
Target Start/End: Original strand, 3893914 - 3894185
Alignment:
| Q |
9 |
gaagaatattattatgcaaagaggatccacaaacacaatccacatggagagcaagaaaagataagttaggattacatgggacaatgatgtccacaagttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3893914 |
gaagaatattattatgcaaagaggatccacaaacacaatccacatggagagcaagaaaagataagttaggattacatgggacaaggatgtccacaagttt |
3894013 |
T |
 |
| Q |
109 |
catttcacgtcaccacaaaaaacaatctaccagcattgaagcacgtggcagatgtccaagcaaacgtggcaaattaagtacacatggcaacccaacatgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894014 |
catttcacgtcaccacaaaaaacaatctaccagcattgaagcacgtggcagatgtccaagcaaacgtggcaaattaagtacacatggcaacccaacatgt |
3894113 |
T |
 |
| Q |
209 |
ttgccaccttttacttctaacatgcagtcctcgtatatcggtgacaaaccgttcactttataaaccgatcaa |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894114 |
ttgccaccttttacttctaacatgcagtcctcgtatatcggtgacaaaccgttcactttataaaccgatcaa |
3894185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University