View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17123_low_31 (Length: 258)
Name: NF17123_low_31
Description: NF17123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17123_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 14 - 239
Target Start/End: Original strand, 7110189 - 7110411
Alignment:
| Q |
14 |
aacctgtgttttataatggattgtttgttcttcaagatcgtcatctttagattggcaacgaagagtcaagggtgttggatttggagccttcaccatattg |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7110189 |
aacctgtgttttataatggattgtatgttcttcaagatcgtcatctttagattggcaacgaagagtcaagggtgttggatttggagccttcaccttattg |
7110288 |
T |
 |
| Q |
114 |
ataatataaactgttgtatggcgaagcaagattggtagagttggagcctgcacgttattgttaataatagctatagtctctctag---ccgtgaatgcaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||||||| ||| |||||||| |
|
|
| T |
7110289 |
ataatataaactgttgtatggcgaagcaagattggtagagttggagcctgcaccttattgt------tagctacagtctctctagccaccgcgaatgcaa |
7110382 |
T |
 |
| Q |
211 |
atagtatgattaagagtattgaaaacttt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7110383 |
gtagtatgattaagagtattgaaaacttt |
7110411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 235
Target Start/End: Original strand, 7116451 - 7116506
Alignment:
| Q |
180 |
atagctatagtctctctagccgtgaatgcaaatagtatgattaagagtattgaaaa |
235 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
7116451 |
atagctatagtctctctagccacgaatgcaactagtatgattagtagtattgaaaa |
7116506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 83
Target Start/End: Complemental strand, 9036849 - 9036816
Alignment:
| Q |
50 |
atcgtcatctttagattggcaacgaagagtcaag |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9036849 |
atcgtcatctttagattggcaacgaagagtcaag |
9036816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University