View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17123_low_36 (Length: 249)
Name: NF17123_low_36
Description: NF17123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17123_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 33139366 - 33139449
Alignment:
| Q |
1 |
tattgggttatcatcaccattgttgcaattgttactcagtttgaatgtctcactactaattcgtaagtttaattattgtttttt |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33139366 |
tattgggttatcatcaccattgttgcaattgttactcagtttgaatgtctcaccactaattcgtaagtttaattattgtttttt |
33139449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 33180606 - 33180682
Alignment:
| Q |
1 |
tattgggttatcatcaccattgttgcaattgttactcagtttgaatgtctcactactaattcgtaagtttaattatt |
77 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
33180606 |
tattgggttatcaacaccattgttgcaattgttactcagattgaatgcctcactactgattcgtaagtttacttatt |
33180682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 3 - 70
Target Start/End: Complemental strand, 33289490 - 33289423
Alignment:
| Q |
3 |
ttgggttatcatcaccattgttgcaattgttactcagtttgaatgtctcactactaattcgtaagttt |
70 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
33289490 |
ttgggttatcatcaccattgttacaattgttactcagattgaatgtctcactactgattcgtaagttt |
33289423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 33139524 - 33139586
Alignment:
| Q |
148 |
atgttaaaaccttgctttgtttataatcaagttagcaacattatatgagtcaataacttcattaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
33139524 |
atgttaaaaccttgctttgtttataatcaagttagcaacattata--agtcaaaaacttcattaa |
33139586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 33157791 - 33157859
Alignment:
| Q |
1 |
tattgggttatcatcaccattgttgcaattgttactcagtttgaatgtctcactactaattcgtaagtt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| || || ||| ||||||||||| |
|
|
| T |
33157791 |
tattgggttatcatcaccattgttgcaattgttactcagattgaatgccttacaactgattcgtaagtt |
33157859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University