View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17125_high_18 (Length: 358)
Name: NF17125_high_18
Description: NF17125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17125_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 343
Target Start/End: Original strand, 10704349 - 10704690
Alignment:
| Q |
1 |
ggaccaaaatcttacaagatcacatattcacatggcagtgaaaatttgagaaggggtaaaattatgaaatttaaattaggattctctcatacgatttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
10704349 |
ggaccaaaatcttacaagatcacatattcacatgtcagtgaaaatttgagaaggggtaaaattatgaaacttaaattaggattctctcaatcgatttatc |
10704448 |
T |
 |
| Q |
101 |
tttaacttgagtttagtttggattaatcagttctttcatatcaacatatatgtctcttctaaacattggccttattgaaatccggtaaatatgcatggtt |
200 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10704449 |
tttaacttgagtttagtttagatcaatcacttctttcatatcaacatatatgtctcttctaaacattagccttattgaaatccggtaaatatgcatggtt |
10704548 |
T |
 |
| Q |
201 |
gagcggtggacaatatggtcaccgtaattttattttatctcttttcactttgatttttaaaagcttcaatgtatagcttttgatcctacgtgattttcga |
300 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10704549 |
gagc-gtggacaatatggtcactgtaattttattttatctcttttcactttgatttttaaaagcttcaatgtatagcttttgatcctacgtgattttcca |
10704647 |
T |
 |
| Q |
301 |
ctgtaattttggtgtttgccaaacacacactaacttagaaggt |
343 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10704648 |
ccgtaattttggtgtttgccaaacacacactaacttagaaggt |
10704690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University