View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17125_high_22 (Length: 318)
Name: NF17125_high_22
Description: NF17125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17125_high_22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 17659127 - 17658810
Alignment:
| Q |
1 |
ataagttattataaacaaggtaaaattgtattgtgtttgtgttttccaatgctcacctttggcaggaaataacagttggtaatgatgcaatatgcaacga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17659127 |
ataagttattataaacaaggtaaaattgtattgtgtttgtgtttttcaatgctcacctttggcaggaaataagagttggtaatgatgcaatatgcaacga |
17659028 |
T |
|
| Q |
101 |
gacaagcatagcatacttgagcaactggactgaatccccagttcatgatccacatataagctaagaattgcctaaaagaaagtttatcaaaaatggcacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17659027 |
gacaagcatagcatacttgagcaactggactgaatccccagttcatgatccacatataagctaagaattgcctaaaagaaagtttatcaaaaatggcacc |
17658928 |
T |
|
| Q |
201 |
aaaaataggacaatgtttgctaaagaagatctcgagcattccggtggcccatctcttatgttgagccatacaggtggggccatcaattggagcacaacct |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17658927 |
aaaaacaggacaatgtttgctaaagaagatctcgagcattccggtggcccatctcttatgttgagccatacaggtggggccatcaattggagcacaacct |
17658828 |
T |
|
| Q |
301 |
gtgaaggctattggatcc |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
17658827 |
gtgaaggctattggatcc |
17658810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University