View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17125_high_23 (Length: 311)
Name: NF17125_high_23
Description: NF17125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17125_high_23 |
 |  |
|
| [»] scaffold0354 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0354 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: scaffold0354
Description:
Target: scaffold0354; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 10626 - 10456
Alignment:
| Q |
1 |
attctgctgggaagaaagctgatgagtgatgataaattggtttacacattgttgtaatttctttgaattaatgtttattttgtatgattcttgtgttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10626 |
attctgctgggaagaaagctgatgagtgatgataaattggtttacacattgttgtaatttctttgaattaatgtttattttgtatgattcttgtgttttt |
10527 |
T |
 |
| Q |
101 |
tgtcccctaacatctatgctagtttcattgttagcatatttcatgtgtcaaagggacaagaagaaacataa |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10526 |
tgtcccctaacatctatgctagtttcattgttagcatatttcatgtgtcaaagggacaagaagaaacataa |
10456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0354; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 210 - 295
Target Start/End: Complemental strand, 10455 - 10370
Alignment:
| Q |
210 |
ctagttttagaagtgtatagtatttatggctgatagataacattgtgattcttggtattgtgtaattataaaaacattcaataaaa |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10455 |
ctagttttagaagtgtatagtatttatggctgatagataacattgtgattcttggtattgtgtaattgtaaaaacattcaataaaa |
10370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University