View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17125_high_29 (Length: 261)
Name: NF17125_high_29
Description: NF17125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17125_high_29 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 7 - 261
Target Start/End: Original strand, 33672671 - 33672925
Alignment:
| Q |
7 |
tcgaagaaaatcatgtgttttgatgtcggacaccttcgagtagaagtgttgatgctacaaaggagaaacatatttaannnnnnnnnnnnn-agtttagtt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33672671 |
tcgaagaaaatcatgtgttttgatgtcggacaccttcgagtagaagtgttgatgctacaaaggagaaacatatttaatttttattttttttagtttagtt |
33672770 |
T |
|
| Q |
106 |
tatggttggtgttattatttattgnnnnnnnntgggacccattatacattttttaacatgatcattgttgttgtttttatgttatgccccactgggccat |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33672771 |
tatggttggtgttattatttattgtaaaaa--tgggacccattatacattttttaacatgatcattgttgttgtttttatgttatgccccactgggccat |
33672868 |
T |
|
| Q |
206 |
tgacattgattcttcatg-nnnnnnnnngtgttatctatgatgtatgagatctataa |
261 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33672869 |
tgacattgattcttcatgttttttttttgtgttatctatgatgtatgagatctataa |
33672925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University