View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17125_high_34 (Length: 239)
Name: NF17125_high_34
Description: NF17125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17125_high_34 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 96 - 239
Target Start/End: Original strand, 46183918 - 46184061
Alignment:
| Q |
96 |
cagatgaaagttaccttcctaagaaattgatgagcattgtgaaccagcttccaagtgctttgctgagcagcaccttctgttttgggataagagaatccag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46183918 |
cagatgaaagttaccttcctaagaaattgatgagcattgtgaactagcttccaagtgctttgctgagcagcaccttctgttttgggataagagaatccag |
46184017 |
T |
|
| Q |
196 |
tacccgcaggcaaatccaaaaatataatattacttacctgtcca |
239 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184018 |
tacccacaggcaaatccaaaaatataatattacttacctgtcca |
46184061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 148
Target Start/End: Complemental strand, 7046234 - 7046193
Alignment:
| Q |
107 |
taccttcctaagaaattgatgagcattgtgaaccagcttcca |
148 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||||| |
|
|
| T |
7046234 |
taccttcctaagaaattgatgagtattgtgaactagtttcca |
7046193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 139
Target Start/End: Complemental strand, 7038954 - 7038922
Alignment:
| Q |
107 |
taccttcctaagaaattgatgagcattgtgaac |
139 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
7038954 |
taccttcctaagaaattgatgagcatggtgaac |
7038922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University