View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17125_low_13 (Length: 384)
Name: NF17125_low_13
Description: NF17125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17125_low_13 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 114 - 384
Target Start/End: Complemental strand, 39000552 - 39000289
Alignment:
| Q |
114 |
aaagaaactaggtttataaaactgtgttatatggctggcaaaggaaaggaaaatcaaatgagtatgtttgttttttgttattaaaatgttcaccaatcat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39000552 |
aaagaaactaggtttataaaactgtgttatatggctggcaaaggaaa-----atcaaatgagtatgtttgttttttgttattaaa-tgttcaccaatcat |
39000459 |
T |
 |
| Q |
214 |
gttggttgtgtggggttggaattaagtggtccaggccatatataatgtaatcagttacaacttacaagtgtaataaaataacccatgtcagtcaatccta |
313 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000458 |
gttggttgtgtggggttggaattgagtggtccaggccatatataatgtaatcagttacaacttacaagtgtaataaaataacccatgtcagtcaatccta |
39000359 |
T |
 |
| Q |
314 |
actcgggtataaccaaccggtcggtttgattcaattttcaaacatgtttggcttggtttggttcgctttat |
384 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39000358 |
actcgggtataacc-accggtcggtttcattcaattttcaaacatgtttggattggtttggttcgctttat |
39000289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 16 - 79
Target Start/End: Complemental strand, 39000613 - 39000550
Alignment:
| Q |
16 |
atgaatcctaagagggctgttgctagtaggaagaaattatgaggcagatccatgtgttgtcaaa |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000613 |
atgaatcctaagagggctgttgctagtaggaagaaattatgaggcagatccatgtgttgtcaaa |
39000550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University