View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17125_low_38 (Length: 237)

Name: NF17125_low_38
Description: NF17125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17125_low_38
NF17125_low_38
[»] chr4 (2 HSPs)
chr4 (1-221)||(21835475-21835693)
chr4 (167-207)||(27112157-27112197)
[»] chr5 (3 HSPs)
chr5 (16-99)||(28524455-28524538)
chr5 (167-208)||(26718885-26718926)
chr5 (167-208)||(26988629-26988670)
[»] chr6 (1 HSPs)
chr6 (167-207)||(2477525-2477565)
[»] chr1 (1 HSPs)
chr1 (167-207)||(6221810-6221850)
[»] chr3 (1 HSPs)
chr3 (26-123)||(13472757-13472851)
[»] chr2 (3 HSPs)
chr2 (167-202)||(11952534-11952569)
chr2 (167-221)||(37182766-37182820)
chr2 (167-208)||(12694801-12694842)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 21835693 - 21835475
Alignment:
1 tttcctggatctcctcctgtagcatacacaaaatgaatcaacaatgaaaatttctcattttttaaatgtcactcaattaattgtgaagcccacacccaac 100  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21835693 tttcctggatctcctcctgtag--tacacaaaatgaatcaacaatgaaaatttctcattttttaaatgtcactcaattaattgtgaagcccacacccaac 21835596  T
101 taacaatcacaactgcaaaaatatagatccagcggctagatactaccagaactttgggctagatccttttattacgggtctcttttcactttcagaaccg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21835595 taacaatcacaactgcaaaaatatagatccagcggctagatactaccagaactttgggctagatccttttattacgggtctcttttcactttcagaaccg 21835496  T
201 agtctccgaaaacttaggaac 221  Q
    |||||||||||||||||||||    
21835495 agtctccgaaaacttaggaac 21835475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 27112157 - 27112197
Alignment:
167 ttttattacgggtctcttttcactttcagaaccgagtctcc 207  Q
    ||||||||||||||||||||||||| |||||||||| ||||    
27112157 ttttattacgggtctcttttcacttacagaaccgagcctcc 27112197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 28524455 - 28524538
Alignment:
16 cctgtagcatacacaaaatgaatcaacaatgaaaatttctcattttttaaatgtcactcaattaattgtgaagcccacacccaa 99  Q
    |||||||||||||||||||||||||| ||||  |||||| ||||||| ||||||||||||| | ||||||||| |||| |||||    
28524455 cctgtagcatacacaaaatgaatcaataatgttaatttcccatttttcaaatgtcactcaaatgattgtgaagtccacgcccaa 28524538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 26718926 - 26718885
Alignment:
167 ttttattacgggtctcttttcactttcagaaccgagtctccg 208  Q
    ||||||||||||||||||||||||| |||||||||| |||||    
26718926 ttttattacgggtctcttttcacttacagaaccgagcctccg 26718885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 26988670 - 26988629
Alignment:
167 ttttattacgggtctcttttcactttcagaaccgagtctccg 208  Q
    ||||||||||||||||||||||||| |||||||||| |||||    
26988670 ttttattacgggtctcttttcacttacagaaccgagcctccg 26988629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 2477565 - 2477525
Alignment:
167 ttttattacgggtctcttttcactttcagaaccgagtctcc 207  Q
    ||||||||||||||||||||||||| |||||||||| ||||    
2477565 ttttattacgggtctcttttcacttacagaaccgagcctcc 2477525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 6221810 - 6221850
Alignment:
167 ttttattacgggtctcttttcactttcagaaccgagtctcc 207  Q
    |||||||||||||||||||||| || |||||||||||||||    
6221810 ttttattacgggtctcttttcatttacagaaccgagtctcc 6221850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 123
Target Start/End: Complemental strand, 13472851 - 13472757
Alignment:
26 acacaaaatgaatcaacaatgaaaatttctcattttttaaatgtcactcaattaattgtgaagcccacacccaactaacaatcacaactgcaaaaata 123  Q
    |||||||||||||||||  ||| |||||  | ||||| ||||||| ||| ||| ||||||||||| |||||||| |   |||||||| ||||||||||    
13472851 acacaaaatgaatcaaccgtgataatttgccgtttttcaaatgtcgctcgattgattgtgaagccaacacccaatt---aatcacaattgcaaaaata 13472757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 202
Target Start/End: Complemental strand, 11952569 - 11952534
Alignment:
167 ttttattacgggtctcttttcactttcagaaccgag 202  Q
    ||||||||||||||||||||||||| ||||||||||    
11952569 ttttattacgggtctcttttcacttacagaaccgag 11952534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 221
Target Start/End: Original strand, 37182766 - 37182820
Alignment:
167 ttttattacgggtctcttttcactttcagaaccgagtctccgaaaacttaggaac 221  Q
    ||||||||||||||||||||||||| |||| ||||| ||||| |  |||||||||    
37182766 ttttattacgggtctcttttcacttacagagccgagcctccggattcttaggaac 37182820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 12694801 - 12694842
Alignment:
167 ttttattacgggtctcttttcactttcagaaccgagtctccg 208  Q
    ||||||||||||||||||||||||| |||| ||||| |||||    
12694801 ttttattacgggtctcttttcacttacagagccgagcctccg 12694842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University