View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17128_low_2 (Length: 323)
Name: NF17128_low_2
Description: NF17128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17128_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 52 - 306
Target Start/End: Original strand, 38060374 - 38060623
Alignment:
| Q |
52 |
ggaatcatcttcagctgtagatgatcgttctcgcc-ggtaatactgattgggatggtcacactgttggacacgcggttgtctgacaaactcaaaactagg |
150 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38060374 |
ggaatcatcttgagccgtagatgatcgttctcggttggtaatactgattgggatggtcacactgttggacacgcggttgtatgacaaactcaaaactaa- |
38060472 |
T |
|
| Q |
151 |
acaaactgcctaaacttctatttcttaaaaaagaaaatacacatataaaatgttagaacacaatcaaccacttttacacttacacacagacgaacttgtt |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
38060473 |
acaaactgcctaaacttctatttattaaaaaa---aatacacatataaaatgttagagcacaatcaatcacttttacacttacacacagacacacttgtt |
38060569 |
T |
|
| Q |
251 |
tttcactttctgg-tttgttaccagagatgaagaagaagattagaaaaagggagaaa |
306 |
Q |
| |
|
||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38060570 |
tttcactttctggttttgtcaccagagat---gaagaagattagaaaaagggagaaa |
38060623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 84
Target Start/End: Complemental strand, 10101016 - 10100987
Alignment:
| Q |
55 |
atcatcttcagctgtagatgatcgttctcg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10101016 |
atcatcttcagctgtagatgatcgttctcg |
10100987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University