View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17129_low_1 (Length: 378)
Name: NF17129_low_1
Description: NF17129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17129_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 28 - 365
Target Start/End: Complemental strand, 5895269 - 5894932
Alignment:
| Q |
28 |
atttgttgagttggccttgcaaaatttagaatatgcgccgaataaagctctaatatttttcaggtgggtggagaagagtgggcaatttaagcatgacgaa |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| ||| | ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5895269 |
atttgttgagttggccttacaaaatttagaa-atgtgcctagtaaagctttaatatttttcaggtgggtggagaagagtgggcagtttaagcatgacgaa |
5895171 |
T |
 |
| Q |
128 |
ctaaagcacactaagatggcgatgattcttcaaagcgagtatttgattgatcagttttggaagttagtttatgatatgaggagtgctggattcaagatag |
227 |
Q |
| |
|
| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5895170 |
cgtaagtatactaagatggcgatgattcttcaaagcgagtatttgattgatcagttttggaagttagtttatgatatgaggagtgctggattcaagatag |
5895071 |
T |
 |
| Q |
228 |
gagaaaatacctatctttcctttcatgaaagctttattttgaagaaaatgcttaaggatgctgttaagctttatgagtttgttatgactggtcctaacaa |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5895070 |
gagaaaatacctatctttcctttcatgaaagctttattttgaagaaaatgcttaaggatgctgtgaagctttatgagtttgttatggctggtcctaacaa |
5894971 |
T |
 |
| Q |
328 |
-agcctaggttgtagacaattattgagtagtattgtttc |
365 |
Q |
| |
|
| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
5894970 |
gaacctaggttgtagaaatctattgagtagtattgtttc |
5894932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University