View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1712_high_27 (Length: 278)

Name: NF1712_high_27
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1712_high_27
NF1712_high_27
[»] chr4 (1 HSPs)
chr4 (42-113)||(13082975-13083046)


Alignment Details
Target: chr4 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 42 - 113
Target Start/End: Original strand, 13082975 - 13083046
Alignment:
42 atttgacataccacattcttaagactttgttattattagagatgttaaaaatatataggcttgatgtaatca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13082975 atttgacataccacattcttaagactttgttattattagagatgttaaaaatatataggcttgatgtaatca 13083046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University