View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1712_high_27 (Length: 278)
Name: NF1712_high_27
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1712_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 42 - 113
Target Start/End: Original strand, 13082975 - 13083046
Alignment:
| Q |
42 |
atttgacataccacattcttaagactttgttattattagagatgttaaaaatatataggcttgatgtaatca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13082975 |
atttgacataccacattcttaagactttgttattattagagatgttaaaaatatataggcttgatgtaatca |
13083046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University