View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1712_high_32 (Length: 255)
Name: NF1712_high_32
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1712_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 84 - 240
Target Start/End: Complemental strand, 31261862 - 31261706
Alignment:
| Q |
84 |
aagtgttatgcattgtggtttgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtcattgtgattggtgagtga |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261862 |
aagtgttatgcattgtggtttgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtcattgtgattggtgagtga |
31261763 |
T |
 |
| Q |
184 |
gaaagagtgttgagaatggaaatgaatgagggaagtttgctactttgctatatgtgt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261762 |
gaaagagtgttgagaatggaaatgaatgagggaagtttgctactttgctatatgtgt |
31261706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University