View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1712_high_44 (Length: 236)
Name: NF1712_high_44
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1712_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 7420065 - 7419843
Alignment:
| Q |
1 |
tatgagtctacggtaatttata--attaaaacnnnnnnncaattagaggaataaataactaatcgtgtttcttattttcacccaagagctcgattgatgt |
98 |
Q |
| |
|
||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7420065 |
tatgagtctacagtaatttatataattaaaactttttttcaattagaggaataaataactaatcgtgtttcttattttcacccaagagctcgattgatgt |
7419966 |
T |
 |
| Q |
99 |
gattcttaggatttgtattgtaaacaaagtggataccaactgcgcacgtcctctnnnnnnnnccgcattaataagatcttgataaattaacaaatcattt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7419965 |
gattcttaggatttgtattgtaaacaaagtggataccaactgcgcacgtcctctaaaaaaaaccgcattaataagatcttgataaattaacaaatcattt |
7419866 |
T |
 |
| Q |
199 |
gataatatgaatcttgtttaaac |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7419865 |
gataatatgaatcttgtttaaac |
7419843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University