View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1712_low_29 (Length: 277)
Name: NF1712_low_29
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1712_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 50642835 - 50642657
Alignment:
| Q |
1 |
taggaaattgttattctagttactataggctatatagctagagaagtgggcagtatcttttggttattcaattcaattttgttttggtaaataaattcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50642835 |
taggaaattgttattctagttactataggctatatagctagagaagtgggcagtatcttttggttattcaattcaatttttttttggtaaataaattcaa |
50642736 |
T |
|
| Q |
101 |
aagctatttttagttgataatattatggtgtatgtttaaaaggctatggttatgatttaaatcaattatggttacacca |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
50642735 |
aagctatttttagttgataatattatggtgtatgtttaaaaggctatggttatgatttaaatcaattgtggttgcacca |
50642657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University