View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1712_low_32 (Length: 258)
Name: NF1712_low_32
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1712_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 30 - 245
Target Start/End: Original strand, 8385203 - 8385418
Alignment:
| Q |
30 |
tgttacctgattggttatggcggaacttatgagtgttttaagatcatcagcatgttgataaagtgtctttttactcgggtatagtacaagatcattttgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8385203 |
tgttacctgattggttatggcggaacttatgagtgttttaagatcatcagcatgttgataaagtgtctttttactcgggtatagtacaagatcattttgt |
8385302 |
T |
 |
| Q |
130 |
gcttctttgagctcatctagtgtttcatcaatggtttccaaacaatcatgaagagcaattttctctcttttagtaagactttttcgcaaaagaagttttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8385303 |
gcttctttgagctcatctagtgtttcatcaatggtttccaaacaatcatgaagagcaattttctctcttttagtaagactttttcgcaaaagaagttttt |
8385402 |
T |
 |
| Q |
230 |
cgacggtgaagtaatt |
245 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8385403 |
cgacggtgaagtaatt |
8385418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University