View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1712_low_44 (Length: 238)
Name: NF1712_low_44
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1712_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 2835589 - 2835808
Alignment:
| Q |
1 |
taagttggttgattcgttcctttgtgaagctgctgttgatgctaatttgaggttggatgagtttgttactcttgctggtgctcttccaagtcatgctaga |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2835589 |
taagttggttgattcgtacctttgtgaagctgctgttgatgctaatttgaggttggatgagtttgttactcttgctggtgctcttccaagtcatgctaga |
2835688 |
T |
|
| Q |
101 |
gctactgatgatggtttgtatagagccattgatacttacctaaaagtatgttttctctatcttggatgtttcaatctttattttgttttatacatgaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2835689 |
gctactgatgatggtttgtatagagccattgatacttacttaaaagtatgttttctttatcttggatgtttcaatctttattttgttttatacatgaaag |
2835788 |
T |
|
| Q |
201 |
tatgttttgttagcagcggt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2835789 |
tatgttttgttagcagcggt |
2835808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 25 - 156
Target Start/End: Complemental strand, 44265354 - 44265223
Alignment:
| Q |
25 |
tgaagctgctgttgatgctaatttgaggttggatgagtttgttactcttgctggtgctcttccaagtcatgctagagctactgatgatggtttgtataga |
124 |
Q |
| |
|
|||||||| | | |||||||||||||| ||| | |||||||| | ||||||||||||||||| | |||||| |||||||||||||||||||| |||||| |
|
|
| T |
44265354 |
tgaagctggtttggatgctaatttgagtttgtctcagtttgttgcacttgctggtgctcttcctaatcatgcaagagctactgatgatggtttatataga |
44265255 |
T |
|
| Q |
125 |
gccattgatacttacctaaaagtatgttttct |
156 |
Q |
| |
|
|||||||| ||||| || |||||| ||||||| |
|
|
| T |
44265254 |
gccattgacacttatcttaaagtacgttttct |
44265223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University