View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1712_low_51 (Length: 215)
Name: NF1712_low_51
Description: NF1712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1712_low_51 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 3 - 215
Target Start/End: Original strand, 41490649 - 41490861
Alignment:
| Q |
3 |
ctttaagcttactttcttaacctctttaaagtggacttataggaaaattgcttaacttaattttctcttattattaaaatagattatatacaagcacnnn |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41490649 |
ctttaagcttactttcttaacctctttaaagtggacttataggaaaattgcttaacttaattttctcttattattaaaatagattatatacgagcacttt |
41490748 |
T |
 |
| Q |
103 |
nnnnagggtttatatataatcaattatgatgataattgtggagctgcaaattagttatttattcaaacatggttttgccaatttattcgcccattatcta |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41490749 |
ttttagggtttatatataatcaattatgatgataattgtggagctgcaaattagttatttattcaaacatggttttgccaatttattcgcccattatcta |
41490848 |
T |
 |
| Q |
203 |
tacacttctaatt |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41490849 |
tacacttctaatt |
41490861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University