View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1713-Insertion-1 (Length: 191)
Name: NF1713-Insertion-1
Description: NF1713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1713-Insertion-1 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 8 - 191
Target Start/End: Complemental strand, 34060364 - 34060181
Alignment:
| Q |
8 |
attcctaccgcctctttaatataatgtcttgatcgaattctcaaaggtgggacttttacttggcatagctcaccaaactctcttccacttcgttgctggc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34060364 |
attcctaccgcctctttaatataatgtcttgatcgaattctcaaaggtgggacttttacttggcatagctcaccaaactctcttccacttcgttgctggc |
34060265 |
T |
|
| Q |
108 |
ttgttgtaattctccgttctcctgtctgatgaaacctgtgtaagatcattgcaaagttgataaagttgtcgtactctttggaga |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34060264 |
ttgttgtaattctccgttctcctgtctgatgaaacctgtgtaagatcattgcaaagttgataaagttgtcgtactctttggaga |
34060181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 22231904 - 22232076
Alignment:
| Q |
14 |
accgcctctttaatataatgtcttgatcgaattctcaaaggtgggacttttacttggcatagctcaccaaactctcttccacttcgttgctggcttgttg |
113 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||| ||||||||||||||| || |||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
22231904 |
accgcttctttattataatgtcttgatcgaattctcaaatatgggacttttacttgacacagctcaccaaactc-cttccacttcatagctggcttgttg |
22232002 |
T |
|
| Q |
114 |
taattctccgttctcctgtctgatgaaacctgtgtaagatcattgcaaagttgataaagttgtcgtactctttg |
187 |
Q |
| |
|
|| ||||| | ||||| |||||| ||| |||| | ||||| |||||||||||||||| | || |||||||||| |
|
|
| T |
22232003 |
tagttctctgatctccattctgataaaatctgtattagatcgttgcaaagttgataaactcgtggtactctttg |
22232076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University