View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17130_high_33 (Length: 323)
Name: NF17130_high_33
Description: NF17130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17130_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 16 - 293
Target Start/End: Original strand, 34899698 - 34899975
Alignment:
| Q |
16 |
atgcaaatgttataataagataggcaagagataccaaattatcatattgtcagtgatatcatctgcacaaattcacataaaattttgcagttggaagata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34899698 |
atgcaaatgttataataagataggcaagagataccaaattatcatattgtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagata |
34899797 |
T |
|
| Q |
116 |
catacctttcatgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899798 |
catacctttcatgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaat |
34899897 |
T |
|
| Q |
216 |
agcgagagaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899898 |
agcgagagaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University