View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17130_high_44 (Length: 304)
Name: NF17130_high_44
Description: NF17130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17130_high_44 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 188 - 304
Target Start/End: Original strand, 34079653 - 34079769
Alignment:
| Q |
188 |
atatgataattttgattagtgaatgagtgctgatgctgaagaagctgctggaattgttgtgtttgggcctgagattgagatggatgctgactttcttgat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34079653 |
atatgataattttgattagtgaatgagtgctgatgctgaagaagctgctggaattgttgtgtttgggcctgagattgagatggatgctgactttcttgat |
34079752 |
T |
|
| Q |
288 |
tctttggaaaagcctga |
304 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34079753 |
tctttggaaaagcctga |
34079769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 34079488 - 34079558
Alignment:
| Q |
8 |
tgagatgaaggtgcggaaacaaactgagacattgtggagacggcatttgacatctgttgatgatctacaac |
78 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34079488 |
tgagatggaggtgcggaaacaaactgagacattgtggagacggcatttgacatctgttgatgatctacaac |
34079558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University