View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17131_high_31 (Length: 240)
Name: NF17131_high_31
Description: NF17131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17131_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 125 - 225
Target Start/End: Complemental strand, 25039843 - 25039742
Alignment:
| Q |
125 |
tctttcaaacactcattctaatactctcttattaggacaactagcccaatatgagtgcaccaacaatgaagttgtaagtcacat-ttttgaataaaaata |
223 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25039843 |
tctttcaaacactctttctaatactcttttattaggacaactagcccaatatgagtgcaccaacaatgaagttgtaagtcacattttttgaataaaaata |
25039744 |
T |
 |
| Q |
224 |
tt |
225 |
Q |
| |
|
|| |
|
|
| T |
25039743 |
tt |
25039742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 15 - 143
Target Start/End: Complemental strand, 25040009 - 25039880
Alignment:
| Q |
15 |
ataggtactggcctgacacaaattctcatgggcatgtgtgtaaaatattgatacattaannnnnnnnaaagtcattacgtcattg-atatagagaaatac |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| | |
|
|
| T |
25040009 |
ataggtactggcctgccacaaattctcatgggcatgtgtgtaaaatattgatacattaattttttttaaagtcattacgtcattgtatatagagaaatgc |
25039910 |
T |
 |
| Q |
114 |
tataaatactctctttcaaacactcattct |
143 |
Q |
| |
|
|||||||| |||||||||||||||| |||| |
|
|
| T |
25039909 |
tataaatattctctttcaaacactctttct |
25039880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University