View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17131_high_34 (Length: 226)
Name: NF17131_high_34
Description: NF17131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17131_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 66 - 215
Target Start/End: Complemental strand, 51286054 - 51285908
Alignment:
| Q |
66 |
atcacgacctttattttatttgaatttacatcgaaactcacatgccgaatatttagttatataataatgatttatttccgtaactattattattctgtta |
165 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51286054 |
atcacgacctttattttatttgaatttgcatcgaaactcacatgccgaatatttagttatataataatgatttatttccgtaactat---tattctgtta |
51285958 |
T |
 |
| Q |
166 |
ctattttcgtggactctattctcttcaccatccctcttttatttattcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51285957 |
ctattttcgtggactctattctcttcaccatccctcttttatttattcat |
51285908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 51286163 - 51286127
Alignment:
| Q |
1 |
tgttcaacatcaagttcacggcaaccccatcactacc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51286163 |
tgttcaacatcaagttcacggcaaccccatcactacc |
51286127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University