View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17131_low_16 (Length: 368)
Name: NF17131_low_16
Description: NF17131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17131_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 22427474 - 22427262
Alignment:
| Q |
14 |
aaataattggctaaaataaacttttgacaccaaaatttctcaattgttcgaatttgaccctgctaattgcaattatgtgattatggtccctcgtattcgc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22427474 |
aaataattggctaaaataaacttttgacaccaaaatttctcaattgttcgaatttgaccctgctaattgcaattatgtgattatggtccctcgtattcgc |
22427375 |
T |
 |
| Q |
114 |
ccaccataaagtgctcacaaaagttatgtatacactttacaactacaggtttcatctccttcgggcaatcatcgtcagaagaacaaggaaggtaacctgc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22427374 |
ccaccataaagtgctcacaaaagttatgtatacactttacaactacaggtttcatctccttcgggcaatcatcgtcagaagaacaaggaaggtaacctgc |
22427275 |
T |
 |
| Q |
214 |
gttgtgaaatgag |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22427274 |
gttgtgaaatgag |
22427262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 43 - 203
Target Start/End: Complemental strand, 22471135 - 22470976
Alignment:
| Q |
43 |
ccaaaatttctcaattgttcgaatttgaccctgctaattgcaattatgtgattatggtccctcgtattcgcccaccataaagtgctcacaaaagttatgt |
142 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||| ||||| ||| ||||||||| ||||||||| |||| | |
|
|
| T |
22471135 |
ccaaactttctcaattgttcgaatttgact-tgctagttgcaattatgtgattatggcccctcatattcaccctccataaagtactcacaaaatttatct |
22471037 |
T |
 |
| Q |
143 |
atacactttacaactacaggtttcatctccttcgggcaatcatcgtcagaagaacaaggaa |
203 |
Q |
| |
|
|||||||||| ||||| |||||| ||| ||| ||| ||| ||||||||| |||||||| |
|
|
| T |
22471036 |
atacactttataactagaggttttatcacctgcggacaactttcgtcagaaacacaaggaa |
22470976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 304 - 351
Target Start/End: Complemental strand, 22427185 - 22427138
Alignment:
| Q |
304 |
atatttgcgccttttgaacaacaaatagagatagaaagatgatgaaag |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22427185 |
atatttgcgccttttgaacaacaaatagagatagaaagatgatgaaag |
22427138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University