View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17131_low_25 (Length: 273)
Name: NF17131_low_25
Description: NF17131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17131_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 256
Target Start/End: Original strand, 31726214 - 31726456
Alignment:
| Q |
14 |
ttctttgtaatgaaaatgtagtaaagtacattgcaggatgtgtgttctttatttgcaaatgaactgtgaggtattgannnnnnnatttcggacatgtttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31726214 |
ttctttgtaatgaaaatgtagtaaagtacattgcaggatgtgtgttctttatttgcaaatgaactgtgaggtattgatttttttatttcggacatgtttt |
31726313 |
T |
 |
| Q |
114 |
ctgaacagaatattttgagagtgtactgtaagtttacaggcattacatcgtctagttataatccgttagttgggtggatgcagggagctctgatacttgc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31726314 |
ctgaacagaatattttgagagtgtactgtaagtttacaggcattacatcgtcaagttataatccgttagttgggtggatgcagggagctctgatacttgc |
31726413 |
T |
 |
| Q |
214 |
aaccnnnnnnnctatcttttcagaaagcttcaaacttataata |
256 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31726414 |
aacctttttttctatcttttcagaaagcttcaaacttataata |
31726456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 14 - 90
Target Start/End: Original strand, 31722712 - 31722787
Alignment:
| Q |
14 |
ttctttgtaatgaaaatgtagtaaagtacattgcaggatgtgtgttctttatttgcaaatgaactgtgaggtattga |
90 |
Q |
| |
|
||||||| ||| ||||||||||||| |||||||||||||| || ||||||||||| |||||| |||| |||||||| |
|
|
| T |
31722712 |
ttctttgaaataaaaatgtagtaaaacacattgcaggatgtatgctctttatttgc-aatgaaatgtgcggtattga |
31722787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 31011392 - 31011345
Alignment:
| Q |
41 |
acattgcaggatgtgtgttctttatttgcaaatgaactgtgaggtattga |
90 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
31011392 |
acattgcaggatgtgt--tctttatttgcaaatgaaatgtgagttattga |
31011345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University