View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17131_low_29 (Length: 248)
Name: NF17131_low_29
Description: NF17131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17131_low_29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 5 - 248
Target Start/End: Complemental strand, 37580043 - 37579793
Alignment:
| Q |
5 |
taaattatactctttattaaaaagcttggcttaactgccacttatcactaatcaaaccaaccaaacaagtcatatgtggttgcagttgtacgtatagtct |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37580043 |
taaattctactctttattaaaaagcttggcttaactgccacttatcactaatcaaaccaaccaaacaagtcatatgtggttgcagttgtacgtatagtct |
37579944 |
T |
 |
| Q |
105 |
ctattaataatattaatattgactct-------tgaggcatcacatattaaattaatttaccataaaaaatttagatttatcatgcatgcgttttgtgtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37579943 |
ctattaataatattaatattgactcttgagtcttgaggcatcacatattaaattaatttaccataaaaaatttagatttatcatgcatgcgttttgtgtt |
37579844 |
T |
 |
| Q |
198 |
taagttgcgctgnnnnnnncagtgactactacattcgaatatagctttaat |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37579843 |
taagttgcgctgtttttttcagtgactactacattcgaatatagctttaat |
37579793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University