View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17131_low_32 (Length: 237)
Name: NF17131_low_32
Description: NF17131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17131_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 37054157 - 37054366
Alignment:
| Q |
11 |
tgagatgaaactctagatgaagttgttaatgaatgtaaagtaaagagtggcattttcaatggtggtgttggcggtggcggtggcggaggaggtggagagg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
37054157 |
tgagatgaaactctagatgaagttgttaatgaatgtaaagtaaagagtggcattttcaatggtggtgttggtggtggcggcggaggaggaggtggagagg |
37054256 |
T |
|
| Q |
111 |
aattagatgtttgtggacattggacaaaggtttcattttcaatctcttggtctttttgttttggactataaggtggttggtgagaatcatttgtgttttg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054257 |
aattagatgtttgtggacattggacaaaggtttcattttcaatatcttggtctttttgttttggactataaggtggttggtgagaatcatttgtgttttg |
37054356 |
T |
|
| Q |
211 |
tggagaacta |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
37054357 |
tggagaacta |
37054366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University