View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17131_low_36 (Length: 226)
Name: NF17131_low_36
Description: NF17131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17131_low_36 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 37579670 - 37579459
Alignment:
| Q |
14 |
tactagcaaacacgtagttgttcaataattaaggtattgaattgaaagggtgattgttgtatttttgttttcacttttggcctattgctatgattttgat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37579670 |
tactagcaaacacgtagttgttcaataattaaggtgttgaattgaaagggtgattgttgtatttttgttttcacttttggcctattgctatgattttgat |
37579571 |
T |
 |
| Q |
114 |
aagaccaaagaagttggggnnnnnnnncaaaagaatcattaataaatagttagaatattgcatattgcttctatggttggctcggtattgaagaatatgc |
213 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37579570 |
aagaccaaagaagtt-gggaaaaaaaacaaaagaatcattaataaatagttagaatattgcatattgcttctatggttggctcggtattgaagaatatgc |
37579472 |
T |
 |
| Q |
214 |
gaacacttttgat |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37579471 |
gaacacttttgat |
37579459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University