View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17131_low_8 (Length: 524)
Name: NF17131_low_8
Description: NF17131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17131_low_8 |
 |  |
|
| [»] scaffold0565 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0565 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 270 - 517
Target Start/End: Complemental strand, 6539 - 6291
Alignment:
| Q |
270 |
tatctctgcgtagagtacnnnnnnnnggaagcactatgtgcttacttacttgatatagtaattttcattttttccttgataataatggccactgcatgcc |
369 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6539 |
tatctctgcgtagagtacttttttttggaggcactatgtgcttacttacttgatatagtaattttcattttt-ccttgataataatggccactgcatgcc |
6441 |
T |
 |
| Q |
370 |
caattaatatgatgttgattttgcgaat--gtataactggcatttattaacatttctatgattcgaaagtgtcaaaatatcaaaatgattgctaatttga |
467 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6440 |
caattaatatgatgttgattttgtgaatatgtataactggcatttattaacatttctatgattcgaaagtgtcaaaatatcaaaatgattgctaatttga |
6341 |
T |
 |
| Q |
468 |
tgcagatgaacttttctagtgctggctttttctataaaaaatagtattat |
517 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6340 |
cgcacatgaacttttctagtgctggctttttctataaaaaatagtattat |
6291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0565; HSP #2
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 18 - 168
Target Start/End: Complemental strand, 6793 - 6643
Alignment:
| Q |
18 |
catcttagtactatcagtgacatttaatgttagttgacgaattcccaaggattcaaccgaccacattacatacaaaggcatgggcaatggattacactcc |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
6793 |
catcttagtactatcagtggcatttaatgttagttgacgaattcccaaggattcaaccgaccacattatatacaaaggcatgggcaatggaatactctcc |
6694 |
T |
 |
| Q |
118 |
atttttattttattttatgatagtgaatatggtgaaggggttaaataatgt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6693 |
atttttattttattttatgatagtgaatatggtgaagggtttaaataatgt |
6643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University