View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17132_high_13 (Length: 330)
Name: NF17132_high_13
Description: NF17132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17132_high_13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 14 - 330
Target Start/End: Complemental strand, 32164817 - 32164501
Alignment:
| Q |
14 |
atgaaagctcaatgagttattattgactctcgagctagacaatcttgcttctaccacaaggccatttactaactctgctgatcttttggtcactttacct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32164817 |
atgaaagctcaatgagttattattgactctcgagctagacaatcttgcttctactacaaggccatttactaactctgctgatcttttggtcactttacct |
32164718 |
T |
|
| Q |
114 |
cctcggacccatcagctcctgccaagctcttcgattcttatgcctgaacggttatctccagctttacaagactcaatttcagaacatgcacatctgcggt |
213 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
32164717 |
cctcgaacccatcagcttctgccaagctcttcgaatcttatgcctgaacggttatctccagctttacaagactcattttcagaacatgcacatctccggt |
32164618 |
T |
|
| Q |
214 |
agggtgattataaaaccagtccagctgcttgttaagaaggtaatttttctttatgatcacacacgatcatgaaaaaagtagatatgatcaaactgccaca |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32164617 |
agggtgattataaaaccagtccagctgcttgttaagaaggtaatttttctttatgatcacacacgatcatgagcaaagtagatatgatcaaactgccaca |
32164518 |
T |
|
| Q |
314 |
ttgacatgtgtagtatt |
330 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32164517 |
ttgacatgtgtagtatt |
32164501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University