View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17132_low_1 (Length: 338)
Name: NF17132_low_1
Description: NF17132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17132_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 51 - 177
Target Start/End: Complemental strand, 32267001 - 32266875
Alignment:
| Q |
51 |
aaccacattggaacaaaatgaaatgatcaaattctgcaaagaatgtgggaaaggttttccttcattgaaagcactttgtggacacatggcttctcattct |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267001 |
aaccacattggaacaaaatgaaatgatcaaattctgcaaagaatgtgggaaaggttttccttcattgaaagcactttgtggacacatggcttctcattct |
32266902 |
T |
|
| Q |
151 |
gagaaagagaaaaagatcaacaaggct |
177 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32266901 |
gagaaagagaaaaagatcaacaaggct |
32266875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 79 - 158
Target Start/End: Complemental strand, 19301476 - 19301397
Alignment:
| Q |
79 |
aaattctgcaaagaatgtgggaaaggttttccttcattgaaagcactttgtggacacatggcttctcattctgagaaaga |
158 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||| ||| ||||||||||| |
|
|
| T |
19301476 |
aaattctgcaaagaatgtggaaaaggttttccatcattgaaagcactgtgtggtcacatggcttgtcactctgagaaaga |
19301397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University