View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_high_17 (Length: 325)
Name: NF17133_high_17
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 79 - 310
Target Start/End: Original strand, 19282613 - 19282835
Alignment:
| Q |
79 |
ttgctgtttctgatcatgttgatgtggctcatcctttaggtatgggaaattttgacaatggtgctaatggtggtgccgccgccggtggtggcgagggtta |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| || ||| || || |
|
|
| T |
19282613 |
ttgctgtttctgatcatgctgatgtggctcatcctttagatatgggaaattttgacaatggtgctagtggtggtgccggcggcgg---------ggtcta |
19282703 |
T |
 |
| Q |
179 |
ttatcagattcagcagcaaggaggagagcaacaaagtaattatcatgttggtgttggtcatgctaatccagttgaggcacagcttttgttatctccacag |
278 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19282704 |
ttatcagattccacagcaaggaggagagcaacaacataattatcatgttggtgttgctcatgctaatccagttgaggcacagcttttgttatctccacag |
19282803 |
T |
 |
| Q |
279 |
aatcaagaagctggtgaggatggtaaaagtgt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19282804 |
aatcaagaagctggtgaggatggtaaaagtgt |
19282835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University