View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_high_25 (Length: 255)
Name: NF17133_high_25
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 72 - 242
Target Start/End: Original strand, 15773429 - 15773599
Alignment:
| Q |
72 |
tacaattatatcttcctaaagtgatgtaataaaatagtgtcattatcaagcatcatactttttctgaattcactcgaagctaggcactatatatgtcttg |
171 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15773429 |
tacaattattttttcctaaagtgatgtaataaaatagtgtcattatcaagcatcatactttttctgaattcactcgaagctaggcaatatatatgtcttg |
15773528 |
T |
|
| Q |
172 |
cgtgctttcctttattttacgaagttcactagaaagagctaagtgagtatctccacactcttctcatattc |
242 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15773529 |
cgtgcttttctttattttacgaagttcactagaaagaggtaagtgagtatctccacactcttctcatattc |
15773599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 15773352 - 15773399
Alignment:
| Q |
28 |
cctaactcccctcatgacccaacaagtatacacttttaaaacgataca |
75 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
15773352 |
cctaactcccctcatgatccaacaagtatactattttaagacgataca |
15773399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University