View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_high_32 (Length: 243)
Name: NF17133_high_32
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_high_32 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 64 - 243
Target Start/End: Complemental strand, 25037233 - 25037054
Alignment:
| Q |
64 |
ttcaacattatttctcttgttgtgcct--aaaaacattactacnnnnnnnnnnnnggaacaaaagaaacatcactactcttttag--agaatgcaatatt |
159 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
25037233 |
ttcaacattatttctcttgttgtgcctggaaaaacattactactatttttttt--ggaacaaaataaacattactactcttttagcgagaatgcaatatt |
25037136 |
T |
|
| Q |
160 |
attacaaatgttattttcttgtgataaccaataacta-gtacttcatgcacttttccacttgagctttccaactctttttccacc |
243 |
Q |
| |
|
| ||||||||||||||||||||||| | ||||||| | |||||||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
25037135 |
a---caaatgttattttcttgtgataaactataactaagaacttcatgcaattttccacttgagatttccaaccctttttccacc |
25037054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University