View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_high_39 (Length: 224)
Name: NF17133_high_39
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_high_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 112 - 210
Target Start/End: Complemental strand, 42391992 - 42391894
Alignment:
| Q |
112 |
atttcagagcttcccaatacttgatcgattatatggcagctgttggagaaattggggtatctgaattccttcaggttcgactttactttattccctttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42391992 |
atttcagagcttcccaatacttgatcgagtatatggcagctgctggagaagttggggtatctgaattccttcaggttcgactttactttattccctttg |
42391894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 42392107 - 42392026
Alignment:
| Q |
1 |
ttattcattcattctcacca---aaatatacttacacacaccattgtacacttcttttcacttcgacttttcttttagttct |
79 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
42392107 |
ttattcattcattctcaccaccaaaatatacttacacacaccattgtacacttctttttacttcgacttttgttttacttct |
42392026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 3186087 - 3186167
Alignment:
| Q |
1 |
ttattcattcattctcaccaaaatatacttacacacaccattgtacacttcttttcacttcgacttttcttttagttctct |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3186087 |
ttattcattcattctcaccaaaatatacttacacacaccattctacacttcttttcacttcgacttttcttttagttctct |
3186167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 112 - 200
Target Start/End: Original strand, 3186185 - 3186274
Alignment:
| Q |
112 |
atttcagagcttcccaatactt-gatcgattatatggcagctgttggagaaattggggtatctgaattccttcaggttcgactttacttt |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3186185 |
atttcagagcttcccaatactttgatcgagtatatggcagctgctggagaaattggggtatctgaattccttcaggttcgacattacttt |
3186274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 112 - 188
Target Start/End: Complemental strand, 38411557 - 38411481
Alignment:
| Q |
112 |
atttcagagcttcccaatacttgatcgattatatggcagctgttggagaaattggggtatctgaattccttcaggtt |
188 |
Q |
| |
|
|||||||||||| | | |||||||||| |||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
38411557 |
atttcagagctttcaattacttgatcgcctatatggcagcttctggagaaattggcttatctgaattccttcaggtt |
38411481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University