View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_low_11 (Length: 413)
Name: NF17133_low_11
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 11 - 397
Target Start/End: Original strand, 52796727 - 52797113
Alignment:
| Q |
11 |
tagattatactatcatgcgattaaggttatgaaatatgctgggaaacccaacgttgcggatttcttccccatattgaagtggcttgaccctcaaggtata |
110 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796727 |
tagattctattatcatgcgattaaggttatgaaatatgctgggaaacccaacgttgcggatttcttccccatattgaagtggcttgaccctcaaggtata |
52796826 |
T |
 |
| Q |
111 |
aggagaaacacacagttccatgttgagagagcttttgagatagcaggatggttcatcaaacaaaggatggaaaatgatactgttggaaatggaaacagta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52796827 |
aggagaaacacacagttccatgttgagagagcttttgagatagcaggatggttcatcaaacaaaggatggaaaatgatattgttggaaatggaaacagta |
52796926 |
T |
 |
| Q |
211 |
aagacttcttggatgtgctcttgcagtttcgtggggatggtgtcagcgggccctacagttttacttcaagaactattaacgttgttgtctttgtaagtag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796927 |
aagacttcttggatgtgctcttgcagtttcgtggggatggtgtcagcgggccctacagttttacttcaagaactattaacgttgttgtctttgtaagtag |
52797026 |
T |
 |
| Q |
311 |
tcaacttcatatttggtatagaaaatatatatgcaggccaatttttcacatcagttctctttttgaatttgtattttataagataag |
397 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52797027 |
tcaacttcatatttggtatagaaaagatatatgcaggctaatttttcacatcagttctctttttgaatttgtcttttataagataag |
52797113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University