View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17133_low_15 (Length: 334)
Name: NF17133_low_15
Description: NF17133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17133_low_15 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 18 - 334
Target Start/End: Original strand, 33764143 - 33764459
Alignment:
| Q |
18 |
agataaggccacagcatctcttgtagcaagtgctacgatgtctgcacatgaaaccgttgatggacatgcagcttcaattgcttcctttacatcgtcaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33764143 |
agataaggccacagcatctcttgtagcaagtgctacgatgtctgcacatgaaaccgttgatggacatgcagcttcaattgcttcctttacatcgtcaatt |
33764242 |
T |
 |
| Q |
118 |
agatcgtagcctctaacactgtcatttgcgcctgtatctttttctgatatgttgttcttggttgaatctatgaggagggatgcatcacaaccctgcacat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33764243 |
agatcgtagcctctaacactgtcatttgcgcctgtatctttttctgatatgttgttcttggttgaatctatgaggagggatgcatcacaaccctgcacat |
33764342 |
T |
 |
| Q |
218 |
ggatgaaaatgtatgttatgaatcgatgtagttgagaatggccgcctagagctaacttaataaacttttcaataattatactatagaaaaataaaatcaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33764343 |
ggatgaaaatgtatgttatgaatcgatgtagttgagaatggccgcctagagctaacttaataaacttttcaataattatactatagaaaaataaaatcaa |
33764442 |
T |
 |
| Q |
318 |
aataattggtcttctct |
334 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33764443 |
aataattggtcttctct |
33764459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 32 - 208
Target Start/End: Original strand, 33759070 - 33759246
Alignment:
| Q |
32 |
catctcttgtagcaagtgctacgatgtctgcacatgaaaccgttgatggacatgcagcttcaattgcttcctttacatcgtcaattagatcgtagcctct |
131 |
Q |
| |
|
|||| ||||||||||| ||||| ||||||||||||||||||||| | |||||| || ||| |||||||||||||||| ||| |||||||| || ||||| |
|
|
| T |
33759070 |
catcccttgtagcaagcgctacaatgtctgcacatgaaaccgttaaaggacatacaactttgattgcttcctttacattgtcgattagatcatatcctct |
33759169 |
T |
 |
| Q |
132 |
aacactgtcatttgcgcctgtatctttttctgatatgttgttcttggttgaatctatgaggagggatgcatcacaac |
208 |
Q |
| |
|
||| | ||||||| ||| | ||||| |||| | || |||| ||||||||||| ||||||| | |||||||||||| |
|
|
| T |
33759170 |
aacgcattcatttgtgccactgtctttctctgctgtggtgttattggttgaatcaatgaggatgaatgcatcacaac |
33759246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 55 - 87
Target Start/End: Complemental strand, 33791081 - 33791049
Alignment:
| Q |
55 |
atgtctgcacatgaaaccgttgatggacatgca |
87 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
33791081 |
atgtctgcacatgaaactgttgatggacatgca |
33791049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University